Announcements of DNA Projects - Family History & Genealogy Message Board

Polglase DNA

duncansbrook — 30 Sep 2007 1:57:01 GMT

Cousin Links?

jostorie — 5 Oct 2008 10:04:39 GMT

I'm not sure if this is where I can get an answer to a question but here goes.
My husband has a great-grandmother (Smith, ugh!) in Kentucky whose parentage is unknown. I believe I know who her sistr was and I know who that ?sister's parents were and I've found a descendent(female) of the supposed sister. But I cannot prove the sisters? to be sisters.
I'm wondering if a dna test from my husband and dna from the female hopeful cousin could prove a family connection? And how close the dna test would prove connection?

Thanks

Hewitt/Hewett genealogy

dmoneta — 12 Mar 2008 3:23:31 GMT

Dear Hewitt/Hewett/Huot Researchers and other versions of the name,

We are a group of people working on our ancestry who have formed a DNA project to help us with our researching. Genetic genealogy is an exciting field that combines the science of DNA testing with the time honored methods of traditional paper trail research. Our group is still rather small, we have sixteen participants, but we have a vast variety of Hewitt and variant lines from many places in the world, including England, Ireland, France, Canada, Australia, and the United States.

One of our participants descends from a long line of Hewetts who immigrated to the Jamestown, Virginia in the early 1600s from Kent, England. Richard Hewitt of this line died in Jamestown in 1622. Family tradition says that he was survived by two sons who went on to produce many descendants that settled in the southeastern part of North Carolina, around Wilmington. The wife of one descendant, James Hewett, born 1721, was Susannah Crump, great-granddaughter of Rev. Richard Buck who married John Rolfe to Pocahontas.

Other participants have stories such as Captain Thomas Hewitt, born in 1630 who resided in Connecticut and died at sea in 1666 and Randall Hewitt born in London and immigrated to New York and died in Cape May, New Jersey. His line settled in Brunswick County, North Carolina.

Descendants of Lacey Hewitt, born about 1815 in East Ruston, Norfolk, England still live in England. Some Hewitts participants descend from families that originated in Ireland, such as Hamilton Hewitt born 1790 in county Cork and Adam Hewitt born 1770 in county Down. Adam immigrated to New Brunswick, Canada as did Mathurin Huot from France who settled in Quebec. One of our participants descends from Edward Hewitt born in 1773 Bishopstone, Wilshire, England; descendants now reside in Australia.

William Joseph Hewitt was born in 1832 in Surrey, England; he immigrated to Bureau County, Illinois as a young man and fought in the American Civil War. He and his wife settled in Nodaway County, Missouri where they raised a large family.

We would like to extend an invitation to anyone who carries the Hewitt/Hewett/Huot or any variation of the name to join our DNA project. The more participants we have the better chance to make connections. Even it you do not have much information about your ancestry, you may be able to match up genetically with someone who does. If you would like to read more about our project, please visit our website at www.familytreedna.com/public/Hewitt.

My name is Daniela Moneta and I am the great-great-granddaughter of William Hewitt who fought in the Civil War. I am the volunteer project coordinator for the Hewitt DNA project. This is a Y-Chromosome DNA study so if you are female, like me (we have X-Chromosomes), you will have to ask a brother, father, or male cousin to test for you. If you have any questions about our project or have questions about DNA testing, I would be happy to answer them.

Sincerely,
Daniela

Thurrott DNA

Bennett3820 — 16 Feb 2008 8:40:22 GMT

Hi,
I am a descendant of John Thurrott and Mary Morton. I would like to know more about the deeper Thurrott roots and think that DNA may help with that. Are there any Thurrott descendants who would be interested in having a DNA test done? You must be the son of a son of a son etc. of James or John Thurrott to have a Y DNA test to indentify Thurrott DNA.

Discounts on DNA test extended

NancyKiser — 29 Aug 2008 11:57:51 GMT

Hello, everyone,

Just wanted to let you know that Family Tree DNA decided to expand and extend their promotion on DNA tests to the end of September. Here are the tests that are on sale:

Y-DNA 12 marker test plus free mtDNA test: $99
Y-DNA 25 marker test plus free mtDNA test: $148
Y-DNA 37 marker test: $119
Y-DNA 37 marker test plus free mtDNA test: $189
Y-DNA 67 marker test: $218
Y-DNA 67 marker test plus free mtDNA test: $288
MtDNAplus test: $149

If anyone out there has been considering getting their DNA tested, this would be an excellent time to do it. These are group rates so you MUST order your test through a group project and you must pay by credit card or your check must be received by September 30, 2008. If you happen to be a Phillips, here is a link to my Phillips DNA project where you can order a test at the reduced rates: https://www.familytreedna.com/surname_join.aspx?code=A77632&...

Nancy Kiser
Administrator
Phillips DNA Project

MAYNARD/MAYNOR/Variants DNA Project Started

Anne W. Nelson — 12 Sep 2003 3:53:29 GMT

I have started a DNA Project to see which of these surnames might be related, and also to help sort out the various lines. There are basically two kinds of DNA tests:
1. Y-Chromosome: requires an ALL MALE line of descent for donor
2. mtDNA: donor may be male or female but it must pass through mother>mother's mother>mother's mother's mother> so on.
There are NO comparisons between a Y-chromosome test and an mtDNA.

Interested parties may email me for further details. I am a MAYNOR researcher in NC/SC/GA/AL.

Y-DNA HAPLOGROUP I 1 B 2( Eye One Bee Two)

jrmcginn1 — 25 Sep 2008 4:25:25 GMT

Hi All
My haplogroup has changed over the past few years from I1C
to the above I suppose with refinement of knowledge etc.

I am a member of the McQueen Study Project managed by Scott Kendall, now part of Ancestry.

I am interested in encouraging all to join surname projects and I am particularly interested in McGinns and surname variants with Irish roots.
Rob McGinn, Ontario Canada

Difference between Ancestry DNA and Family Tree DNA?

ShortTree — 20 Sep 2008 2:52:50 GMT

I am curious about the DNA testing that is offered on Ancestry and have also found Family Tree DNA.

1) What is the difference between the two test groups?

2) Do they share any information ... or are the results limited to the people that have specifically chosen their test?

Thanks,

Jeff

Clueless newbie so confused! FamilyTreeDNA and GenographicProject results

tmdupree — 15 Sep 2008 2:27:43 GMT

I'm sorry if this has been asked already, but I've searched the help and this board and been unable to find an answer.

Is there any type of a tutorial for DNA newbies on how to enter your results into Ancestry.com? I have my results from the Genographic Project as well as Family Tree DNA, but I'm baffled as to how to enter them.

My Genographic Project result code looks like this:
16261T, 16298C, 16311C, 16519C

ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTA
CCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATT
ACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTG
TAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAG
CAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAG
CCACCTCTCACCCACTAGGATACCAACAAACCTACCCACCCTCAACAGTAC
ATAGCACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTT
CTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCACCATCC
TCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCC
CATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTA
CTTCAGGGCCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACA
TCACGATG

Do I just ignore the long line of code, and enter in the:

16261T, 16298C, 16311C, 16519C

If so, do I add the letter in, or use the drop down for the letter code?

Also I tried entering in my FamilyTreeDNA results and got nothing but errors. Is there any guide or how-to for clueless newbies?

Thank you

rare blood donor card-haplotype?

nekocat — 8 Sep 2008 5:08:57 GMT

in front of me is my husband's rare blood donor card. he's type 0+, but after that is R1R1, the 1's being brought down half a line. he's a Moore, which tends mostly to be haplotype R1b1.
my question, is R1R1 his haplotype? or does that designate something else and just look like a haplotype?
I just sent for his Moore dna kit, and I've traced his Moore's back to 1810 Beaver Co., PA, but I've been checking things while we wait for the kit to arrive and this has me curious.
thank you for any information that will help clear this up.

DNA Results with Genetic Percentage

hinklerj — 8 Jun 2008 1:22:07 GMT

I am hoping maybe someone may be able to help in this question. I have been doing a lot of research on DNA and have participated in several tests. One through The National Geographic Project (Haplogroup H)and then had test done for a percentage of genetic ancestry. The percentile results from the genetic ancestry produced an 88 percent European genealogy, which was no surprise. I have found my family history (paternal and maternal) going back to Europe (German, England, Scotland, Ireland). But then the other percentage came up with 12 percent Native American. I have never found any link to Native American through my genealogy. From what I can understand, at 12 percent (it did provide a range of 4 to 20 percent) would mean that my mother or father would have to have been 25 percent. With that my Grand Father or Grand Mother would have had to have been around 50 percent and so on. There is nothing I can find that would point to any of them having Native American. Is there another possible explanation for this percentage or another way that it would have come up so high? There may have been some from farther back as I have been unable to complete some of my tree due to lack of information. My parents and grand parents passed away long ago and my immediate family seemed to have no information. Any suggestions or insight from anyone would be helpful.

Outlaw Ancestry DNA Website

hypnobambie — 30 May 2008 5:19:35 GMT

I am a descendent of an outlaw and know others who are putting together our histories, genealogy and DNA.

We are establishing a web page to gather descendents together and share who our information and DNA which will clear up some interesting stories, and no doubt open up others...

Is anyone interested in more information and joinging our group?

I don't know the surname! :(

ricknlida — 29 Aug 2008 11:09:13 GMT

I have dna results from a family group that we don't know the surname for. It's a long story...

Are there websites where we can search the dna results to find surnames that have matches or close matches?

Thanks!

STANALAND and spelling variation DNA project, participating on STANLEY project

AWStanaland — 30 Aug 2008 12:38:37 GMT

Does your surname share the same genealogy as people bearing the surname STANALAND and all of its spelling variations? DNA testing may help us discover the answer.

My husband was born STANALAND on a line that descends from Hugh STANALAND and Sarah OGDEN ...on a line of STANALANDs with many STANLEYs and variations of STANALAND because the surname was passed along with a variety of spellings. I have read the genealogy research on the line which had 3 known British born immigrants to America in the late 1600s to early 1700s ...Hugh, John and Thomas ..and I have many questions.

Certainly there are surnames that are 'pure' and did not change, but quite often that is not the case. For instance, is STANLEY, STANGELAND, STANGLAND, STENLUND, etc a Scandinavian variation of the STANALAND, etc. surname that has been tracked to the British Isles? Maybe, but DNA is likely the only way to know our deeper, more distant roots and connections.

All the spelling variations of the STANALAND surname may now participate in the STANLEY DNA project on FTDNA.

The administrators of the STANLEY project agreed to add a variety of surnames on the STANALAND / STANLEY family lines to their already organized group project.

In the book "STANALANDs of the U.S." compiled by Schuler D. STANALAND, there are dozens of STANLEYs and several variations of the name STANALAND name that are all part of the same family line and that should share DNA.

If you have a surname spelled
Stanaland, STANLAND, Staniland, Stanoland, STANGLAND, Stangeland, Stanley, STANLY, Standley, Standly, STENLUND, Stanlan or Stanalan, Stanilan....you may learn more about your genealogy than has been so far published, simply by connecting with people who share your DNA.

DNA for genealogical purposes is never a substitute for traditional research to find a paper trail, but DNA often reveals more than you can imagine and often connects you with other people who have enough genealogy on their line to bridge some gaps ...or to offer new clues to your history.

The STANALAND line has some good data accumulated an published in Schuler D. STANALANDs book, as well as a book compiled by Dorothy STANALAND SAMUEL "The Desdendants of Hugh STANALAND, an early settler of Pike County, Alabama ...which covers the descendants of my husband's line. In spite of the genealogy history collected in these publications, there is much we do not know ..and plenty fo room to learn more.

So the answer to 'why participate in a DNA project?' is that we need to work to correct some errors in some of the data and family lore ...

...and we can expand our knowledge and seek some answers for our American, Australia, etc. immigrants across the ocean in the British Isles, and possibly Scandinavia who might be the root ancestors on our common lines.

DNA will give us new answers ...but WE NEED male surname bearing CANDIDATES for the DNA project, which involves only simple mouth swabs that are put in vials and returned to the lab.

Please reply here ...or contact me (connect the spaces) at audstan @ chartertn.net for more information.

Audrey in TN

New DNA Project Amy-Amigh-Emigh, etc. started

FredricZS — 26 Aug 2008 3:12:14 GMT

A new surname project has been established with FTDNA and World Families for the surnames Amy, Amey, Amigh, Amick, Amich, Emigh, Emig, Emick, Emich, Eighmy, Eighmey. To test, you must be a male descendant of one of those families (or any other similar surname). FTDNA has some great price discounts through 31 Aug. 2008, so now is a good time to test.
http://www.familytreedna.com/surname_join.aspx?code=Q13000&a...

If you have any questions about the project, please contact me.

Rick Saunders
Amy-Amigh-Emigh DNA project coordinator

Haplogroup I1a-Stonemans

peggydalton58 — 25 Aug 2008 5:01:27 GMT

I received my fathers DNA under the Dalton DNA progect thru ancestry.com.. When I looked at the others, his numbers really didn't match up to others close enough to say they are related.He was illegitamate, so I do not know if his last name should fall under this project.
Is there anyway of taking his numbers and matching them up to other projects?
He was told his birth father was Frank Dalton and that is what it shows on his birth record.Dad is almost 86 years old.

Any Jewish DNA Connection With Northern Cherokee ?

jadiwa48 — 22 Aug 2008 10:27:39 GMT

I am interested in hearing from anyone that has knowledge of a Jewish (particularly Ashkenazi) connection to the Northern Cherokee. Some of my paternal g-g-grandparents were part Northern Cherokee Indian.

Because of a gene mutation that has recently been discovered in my family, I am looking into the possibility that my family line has a Jewish connection.

The gene is BRCA2, which is a gene mutation for breast and ovarian cancer, as well as other cancers including melanoma and prostate cancer.

If anyone has any information on this subject, I'd appreciate it.

Thank you.

Preston DNA Project

apresto4321 — 20 Aug 2008 6:38:32 GMT

Hello!

The Preston DNA Project now has 21 members. We have several matches at the project, but would like to see more. The more participants that we have in the Project, the more useful the database.

Family Tree DNA is having a sale now through the end of August 2008 for new members. You must join a Project to get the group rates. The YDNA 37 marker test has been reduced to $119 during this sale.

To find out more information on DNA Testing and the Preston DNA Project, please follow this link:

http://www.worldfamilies.net/surnames/preston

Click on the tabs at the top of the page to see the individual pages of the Project.

On a personal note, the Kentucky River Prestons are seeking their ancestors. We believe they were in Virginia before coming to Kentucky in the late 1700s. This has been our dead end for many, many years. Our hopes are to make a connection to a Preston line in Virginia or elsewhere through DNA Testing.

Best Regards,

Angie Preston

is there a

KLoyd41 — 16 Aug 2008 4:07:01 GMT

is there a Losey DNA project on Ancestry?

Discounts on DNA tests at FTDNA

NancyKiser — 16 Aug 2008 3:56:50 GMT

Hello, everyone,

I wanted to let you know that Family Tree DNA is offering some promotions on their DNA tests until the end of the month (August 31, 2008). Here is their announcement:

Y-DNA12 orders include a FREE mtDNA test (Y-DNA12+mtDNA promotion price of $99; normally $189)

Y-DNA25 orders include a FREE mtDNA test (Y-DNA25+mtDNA promotion price of $148; normally $238)

Y-DNA37 orders price REDUCED to $119 (normally $189)

Y-DNA37+mtDNAPlus orders price REDUCED to $189 (normally $339)

Y-DNA67+mtDNAPlus orders price REDUCED to $288 (normally $409)

mtDNAPlus price REDUCED to $149 (normally $189)

Since mtDNA (maternal) DNA tests are not very useful for genealogical purposes, I think the reduced price on the 37 marker yDNA test for men is the best deal. You MUST order your test through a DNA project in order to obtain these prices. These are group rates.

Also, I wanted to announce that I have started my own Phillips DNA Project hosted by Family Tree DNA. If you are a male Phillips and are interested in getting your yDNA tested and analyzed, please contact me at nancy2kiser@yahoo.com.

Sincerely,
Nancy Kiser

dna

KLoyd41 — 16 Aug 2008 3:51:13 GMT

which DNA test is best

DNA questions

faith196238 — 12 Sep 2005 1:49:24 GMT

I guess I'm not fully understanding the DNA project. Would someone explain it as simply as possible. I keep doing the reading but I'm confused as to what test should be done, where the results are located, how do you submit it to genealogy to find matches?
Thanks for any help.

DNA Testing

beshiresjim — 13 Aug 2008 8:30:16 GMT

I recently saw an ad in one of the genealogy magazines from a company called DNA Testings Systems, located in Scotsdale, Az. I went to their website and looked at the different types of tests that they offered and ordered the one they recommended - cost $295.00.
After sending the test swab off, I anxiously awaited the results. In less than two weeks I received a pdf file with their proported results.
They ran 13 markers and came up with my top 20 supposedly matches. Match #1 was Black Ecquadorian, Match #2 was Han Chinese, and the other matches were all Hispanic. I am a white Caucasian male and have traced my lines back to the 15th century and all my ancestors were European. No Ecquadorian nor Chinese, nor Hispanic.
Not the less to say that I was extremely disappointed and e-mailed them with that disappointment. Their reply was that their test was not supposed to give you a DNA match, just general information about your distant ancestors!
This company is a total rip-off and I'd advise anyone looking for a DNA test to avoid them like the plague.

DNA Testing

dispb4 — 12 Aug 2008 4:08:05 GMT

OK, maybe someone can help...
I would like to do a DNA testing...and understand being female there is only one test..But my question/problem is...
I am the youngest of 6..
The first 3 kids are from 1st marraige...all girls
the next 2 from common law live in...boy and girl
me from an affair...dont know who he was...
now I have one brother by another man than my father.
but I do have numerous nephews...could one of them take the test for me...
I want to know before I spend monies and find out cannot do test...Please let me know, greatly appreciated

Cathy
kiki@warwick.net

Nutt DNA project

MarciaMcClure — 12 Aug 2008 10:17:40 GMT

I am working on several families who have very active DNA projects. We need one on the Nutt and similar surnames! The information garnered is incredibly valuable.

Are we all related? Doubtful, but you could stop chasing dead ends. You would be able to concentrate on lines that share your markers and help identify a common male ancestor.

The test is simple. It's just a cheek swab... some spit. Ancestry is running a special through September.
http://dna.ancestry.com/selectTest.aspx;jsessionid=7456BBE0D...?

We need men with the Nutt surname to participate. What is tested are the markers passed from father to son over the generations. This will not tell you anything about the maternal line of your family. Certain markers mutate faster than others, but what we end up with are familial groups who at some point share a common ancestor. You are able to use your matches and their lineages as clues to where to look for your own family. Maybe even more valuable, you learn who you are not related to.

I would be glad to head up the project for the time being, but if someone with web experience and some free time wants to take over, that would be great.

A couple examples of how this has helped my research:

My Pearce/Pierce line. We have several matches and an idea of where our family is from. We are not related to families of the same name who appear in the same counties as we do in NC and TN. I have wasted countless hours trying to figure out how we tie together. No wonder I couldn't because we don't.

My Speer line - and many of you southern Nutts are related to the Speer and Steelman family. Andrew Speer was the original ancestor in Somerset, MD c 1666. There are no other matching lines of Speer/Spear/Speers/Spears, other than Andrew's descendants, in this country until the late 1800's when some come from Ireland. There are some who come from Germany, etc - but they don't match our markers.

Our "Irish" Speer cousins trace their lineage to the Orkney Islands north of Scotland. Our DNA tells us that we are the descendants of Scandinavians, probably Vikings.

Please consider participating! It will give you a specific group that you can exchange information with and research together.

Does ancestry.com DNA have a surname project list?

nwsidechicago — 23 Jul 2008 2:55:48 GMT

My husband is an Upton and trying to decide which DNA testing company to use. I just noticed Ancestry.com is having a sale. I was wondering if ancestry.com has a surname list of people that have used their service and is now listed on there.
We are very new to the DNA thing, and understand the basic stuff like male to male and that your name is entired into a surname list with other Uptons that matched your DNA, I guess.
I did see a project on a yahoo search that has Uptons, but you have to be from that state, or know one of your known ancestors have to be from there, seems strange to me.

WEBB DNA PROJECT STARTED! Please read

Anne W. Nelson — 12 Aug 2008 11:43:49 GMT

Some cousins and I have decided to try to broach our brick wall using DNA analysis. This requires all male lines (ie father -son-grandson-greatgrandson all WEBB). This is a painless self-administered, mail in cheek swab. It can also give ethnic background (English, Irish, Welsh, etc)

My line is stuck in Jefferson Co, GA in the late 1700s, but probably came from NC before the Revolution and VA before that. Descendants went on to AL, MS, TX, and the family may have been in SC for awhile..

The following less common names appear in our line/group and may appear in related lines:
Elias, Stephen, Rice, Brittain/Britton, Matilda, Caroline, Catherine, Milly, Lydia, Brinson, Dicey, Jesse, Samuel.

Related Families: MAYNOR/MANER, RUFFIN, HOLT, DUNN, STRICKLAND, ROBERTS(ON), PATTERSON, BOZEMAN

The costs are reduced when we submit a minimum of 6 samples as a Group. I am serving as the Group Administrator for this study.

If you are stuck on your line, this may help you break through your brick wall. If you have a documented line, this study needs your samples to compare our results TO. Please contact me if you are willing to participate.

I will post regular updates on the progress of the study to the WEBB mailing list on rootsweb and to Genforum and here.

Thank you!

WEBB DNA PROJECT STARTED! Please read

Anne W. Nelson — 12 Aug 2008 11:43:49 GMT

<thread><path>..fh.topics.dnaresearch.projectannouncements</path><threadid>1864</threadid></thread>

Hello Bianchi!

RobynGiana — 6 Aug 2008 3:00:50 GMT

Hello Bianchi!

If you are a male with the last name Bianchi, please participate in the Bianchi DNA project on Ancestry.com!

The price is half off!

Let me know if you have any questions!
RobynGiana@gmail.com

Jewish DNA among Southeastern Indians

strawdog_1 — 11 Apr 2004 1:44:39 GMT

Changes to website at Phillips Worldwide DNA Project

NancyKiser — 30 Jul 2008 5:21:53 GMT

Hello, everyone,

This is Nancy Kiser, the administrator of the Phillips Worldwide DNA Project. As some of you have noticed, World Families decided to make some changes to their website last week. One of the changes involved giving us a new URL, which is now http://www.worldfamilies.net/surnames/phillips. The old address, which is http://www.worldfamilies.net/surnames/p/phillips, is also supposed to still work, but half the time it does not.

When World Families made the changes, the Patriarchs Page got all scrambled up. I have tried to fix it, but I continue to find errors that were introduced by the changes. If your Phillips pedigree is posted on the Patriarchs Page, please go to the Patriarchs Page and make sure your pedigree is correct and is linked with the correct kit number and the correct family group, if applicable.

When World Families made the changes, our Singles Y-DNA chart was permanently deleted. However, there is now more room on the Y-Results page, so I am now able to upload both the Family Groups and the Singletons all on one page, and I have done that.

The navigation for our website at World Families is still located at the top of the page in the gray bar. Just click on whichever page you want to read. Above the gray bar is a black bar that allows you to navigate directly to the different general pages at World Families.

If you have any questions about all this, or if you cannot find your results on the Patriarchs Page or the Y-Results Page, please let me know. I apologize for the inconvenience.

Sincerely,
Nancy Kiser

Half Price DNA testing via Ancestry.com

perl47 — 26 Jul 2008 2:34:55 GMT

Ancestry.com is reducing the price of the Y-DNA tests by 50% until Sept. 30.

The best way to sort out our Phillips ancestry is for males named Phillips to be tested and now is the perfect opportunity.

It's very simple to do the test. The company will send the test kit to your house, you swab the inside of your cheek with the Q-tip type thing they send you, put it in the vial and send it back.

It's so exciting to find matches. Of course, some people get a big surprise, but that's exciting, too.

DNA Results Sites with more imformation than the results

skavoke — 17 Jul 2008 2:59:50 GMT

I am moderating a group in August regarding DNA. We will have already had a speaker on the subject. My goal is to display DNA Results sites where contributors have done more than the results and a lineage.

An example being Georgia Bopp's section on Henry Kenny in the Kenny DNA site.

I want some interesting results sites to share at this meeting or welcome any other ideas which could be appropriate for this type of discussion.

Thanks,
Diane

Needing male Chancey - Chancy - Chauncey DNA for genealogy

Robert Chancey — 29 Jul 2008 1:45:36 GMT

Several of us South Georgia~Florida, Chancy~Chancey's have become involved with using DNA to help us around the stone wall many of us are at.

This DNA group of Chancey's and Chauncey's is not limited to the southern clans...somewhere..there is a bloodline match for all of us, but we must have that Y-DNA (male) sample to compare with our growing Chancey/Chauncey DNA database.

We have so far proven that the 3 main SE Georgia Chancey's are related by bloodline, and the common ancestor is at some period in the 1700s.

We have also proven that we South Georgia Chancey's are not connected by bloodline to the New England Chauncey's, other Chancey branches may very well connect.

We could certainly use some of the other southern (primarily) Chancey's of North Carolina who migrated to SW Georgia and Alabama and beyond in the 1800s.

There are Chancey branches in TN, VA, KY and Westward that could very well tie all of us together.

For additional information how this is accomplished, costs..etc. Please write me at k4yaw at hotmail.com Please put DNA genealogy in the subject line, so that it is not accidentally deleted as spam. I get around 25 to 40 spam mails at Hotmail daily because that is my genealogy contact address..and is posted all over the genealogy forums.

Please try to help our group to grow if you can. Its exciting, and we have already proven much.

Regards, Robert

Should Y-Chromosome Match = Surname Match?

olymau — 16 Apr 2008 5:54:01 GMT

Since the Y-Chromosome is passed down from father to son with the father's surname, should't all Y-Chromosome matches have the same Surname?
If my Y-Chromosome is a close match with someone else, only 2 of 46 Y-Chromosome Markers differ, if we truely are related shouldn't we still have the same surname even though 2 of the markers changed over many generations?
Thank you,
Scott

Update on the Y-DNA Project for the FARRIS Surname Group Which Includes the Surnames of Fairess, Faries, Faris, Farris, etc.

JohnAFarris — 2 Mar 2008 6:07:11 GMT

SUBJECT: Update on the Y-DNA Project for the FARRIS Surname Group Which Includes the Surnames of FAIRESS/FARIES/FARIS/FARRIS/FARRIES/FERRIS/FERRISS/PHARRIS/etc.

(The FARRIS Surname Group has over fifty spellings identified)

I am very pleased to report that we now have twenty-nine (29) participants in our subject project and they all have received their Y-DNA analysis back. These twenty-nine Y-DNA results break down into three different Haplogroups: I1a, I1c & R1b. We have thirteen (13) participants in I1a, one (1) in I1c and fifteen (15) in R1b. We also have eight people who have ordered their Y-DNA test kits, but have not yet mailed them in. I hope that they hurry up & do so soon !!!

The I1a & c Haplogroups are being managed very effectively by my Co-Administrator, Elvin Farris. His thirteen (13) I1a results break down into only two unrelated (at least in a genealogical time frame) clusters. One cluster has eleven related participants (Descendants of Ian Esom Farris), while the other cluster has only two participants. In each cluster the related participants either already know they are related or they are still trying to find out where their branches meet. If you have any questions of these two Haplogroups, Please contact Elvin at <<< Elvin Everett Farris, Jr. (mefarris@bellsouth.net) >>>.

The R1b Haplogroup plus any new Haplogroups that should be identified with the FARRIS/etc. surname group are being managed by me. Within our fifteen R1b participants we have two identified clusters of related people. Mine has seven members who are clearly related -- however, three did not know this until I analyzed their Y-DNA results. We also have two more that may be related, but it will take more testing of additional male relatives to prove it. The other cluster has three participants, one match of which was unexpected. Thus we have four unexpected matches within our R1b participants. This can be very exciting for those participants as it gives them a clear direction for their future research. It can also be a little frustrating if the connection between the two branches is not obvious.

Our results show that the various spellings within our FARRIS surname group are often shown to be related by their Y-DNA results.

Thus far we have identified at least eight unique Y-DNA groups with the FARRIS/etc. surname that came from Europe to the USA. Unfortunately, we do not yet have any participants with an Arab origin. We know they are out there, but none have joined us yet. I hope we will get this corrected soon. The Arab heritage is expected to show a very different Haplogroup. As you may already know, FARRIS in Arabic means "warrior on horseback", and it is a common surname in Arab speaking countries.

This leaves four participants (and perhaps six) that do not yet have a match with any other participant. The solution for helping these four or six strays is to get more participants. The more participants we have the more matches we find and the more problems we solve. Who do you know who is a male with a surname in the FARRIS/etc. surname group as listed above? Talk them into getting tested. If you are a woman, you can sponsor a male. Many of our current participants are women who arranged to have a male tested. In many cases these women remain the primary point of contact for Elvin & me.

To join our study, please go to: <<< www.dnaheritage.com/oracle/join.asp?GroupUnique=873562776 >>> and follow the instructions to order your sample kit. It is a simple, fast, and painless test.

Respectfully submitted,
John

John A. Farris// Albuquerque, NM USA// JohnAFarris@comcast.net

Administrator of the subject project.

Leavitt Y-DNA Project

NALFhistorian — 12 Jul 2008 12:01:32 GMT

The National Association of Leavitt Families (NALF) is an organization formed around the descendants of immigrants John Leavitt of Hingham,MA and Thomas Leavitt of Hampton,NH, both arriving in America in the 1620-30's. Our DNA project was originally started to help us determine if there was any connection between the two men. We welcome any males of the Leavitt, Levett, and Levitt surname (and other variant spellings) that would like to be a part of this undertaking!
As of this writing, we have three non-related Levett/Leavitt lines of English origins.

http://www.familytreedna.com/public/leavitt

John Dow
Historian, NALF

Baltic 204 modal

44040 — 11 Jul 2008 4:43:52 GMT

I have googled this with no luck--what does it mean?

Rapley DNA project

JRapleySauntry — 8 Jul 2008 7:27:44 GMT

Rapley DNA Project to determine Rapley Ancestry and Migration. Our project is hosted by the testing company Family Tree DNA. You can visit their web site at http://www.familytreedna.com/. One Rapley male has been tested there

There is a group discount if you join the "Rapley Surname project".
.To access our group sign-up page, please type Rapley in the search box on the right side of their web page. On the page that is returned, click on the name "Rapley" and an ordering page will be displayed.

Please consider ordering at least the 25-marker kit, as the 12-marker test is considered "low resolution," and often does not provide enough information to determine lineage.

Looking forward to hearing from you.

Jeannette Rapley

Looking For participants for DNA Diaries

StevenMoore151 — 27 Jun 2008 12:53:21 GMT

I am a researcher on the SMG Productions show DNA Stories, and we are looking for people to take part in the programme which helps people trace long-lost relatives through DNA testing.

Due to air in October on Sky Real Lives, it is presented by Lorraine Kelly and this is the second series.

It is filmed in an enclosed studio (no audience) so is designed to be as non-conflict as possible.

To give some examples of people who have contacted us so far, we have heard from by those who have traced their long-lost American GI fathers as well as people who were adopted and think they have found their birth parents.

If you can help, please contact me on emily.henderson@smg.plc.uk or those wishing to participate in the show can call 0871 827 5020, or email dnastories@stv.tv

Swanay/Swaney DNA Project

calgenie — 30 Jun 2008 8:49:47 GMT

I am pleased to announce the Swanay/Swaney (and other variant spellings) DNA Surname Project!

The initial goals of this project are:

1. To determine if the Swanay, Swaney, Swanney, and [other variant spelling] lines are connected.
2. To connect the various lines with their ancestors, and to differentiate between the lines.
5. To find desendants of Miles Swanay and Jane Johnson.
6. To determine if the Tennessee, Kentucky, Ohio, and Pennsylvania lines are related.
7. To identify our immigrant ancestor(s) if possible.
8. To determine our Swanay/Swaney family's native homeland (current data is showing Scotland).
9. To break down those brick walls!

The Swanay/Swaney surname is very rare, so it is difficult to find participants. If you are, or know of, someone with this surname, I hope you/they will consider participating!

In order to participate in the Y-DNA testing, a male participant is required. Many females (like myself) who cannot themselves participate in this study can find a male relative bearing the last name being tested and have this relative represent their line.

We also have participants in a mtDNA project for this surname, but remember that only males carry the Y chromosome and can be linked to the surname.

Testing requires ONLY a simple, painless cheek swab. No needles or blood is required! Also, only DNA pertaining to genealogical research is tested. No medical information is or can be obtained through these tests.

Our project is hosted by the testing company Family Tree DNA. You can visit their web site at http://www.familytreedna.com/.

To access our group sign-up page, please type Swanay or Swaney in the search box on the right side of their web page. On the page that is returned, click on the name "Swanay," and an ordering page will be displayed.

Please consider ordering at least the 25-marker kit, as the 12-marker test is considered "low resolution," and often does not provide enough information to determine lineage.

You can view our public project page at http://www.familytreedna.com/public/swanay.

If you have any questions, please feel free to contact me at: calgenie@verizon.net.

Warmly,

Elizabeth Swanay-O'Neal
Swanay DNA Project Administrator

Announcing the Wigington Surname DNA Project

pjotf — 5 Jun 2007 7:35:03 GMT

My father had his DNA tested in order to try and verify the Wigington lineage his family descends from. Thus far there are only two Wigingtons that have had their DNA tested and they both descend from the same George Wigginton born in VA abt. 1730.

This project is only for males with the surname of Wigington, Wiggington, Wigginton, Wiginton, or any other spelling of our name.

If you are interested in joining the Wigington Surname DNA Project please post a response here and I can send you the details or you can email me directly.

I do not believe I can post the name of the company that hosts the service since that would be advertising, nor can I post the pricing.

Thanks!
Paula

New Hance DNA Project

JamesOgg — 22 Jun 2008 12:25:30 GMT

A new DNA project has been started at FTDNA for Hance descendants.
https://www.familytreedna.com/surname_join.aspx?code=Y40468&...
All name variants are welcome!

Searching for my Grandfather

36gd8824 — 22 Jun 2008 2:48:10 GMT

My father was born out of wedlock in 1940 in Queensland Australia. He was adopted by my grandmother’s husband in 1943. I have no idea who his father was. I have obtained his birth certificate and have been told his fathers name is not listed on any government records. I have read some information about DNA testing and genealogy. I am wondering if anyone has any experience with the DNA process, and do they think I would get results from it. I have a brother and I have read that by testing his DNA I may be able to find my fathers family line.
Any advice would be appreciated.
regards
karen

DNA Result Interpretation

LouiseThompson77 — 12 Jun 2008 12:53:56 GMT

We just got back the DNA results for my father and I need alot of help! Could someone tell me what this halogroup numbers mean! Thanks a Million!
19a 19b 385a 385b 388 389 1 389 11 390 391 392 393 426 437 438 439 440 441 442 444 445 446 447 448 449 452 454 455 456 458 459a 459b 460 461 462 463 464a 464b 464c 464d 464e 464f GGAATIB07 YCAIIb Y-5ATA-A10 635 Y-GATA-H4 1

A general overview will do . Thanks again

New to mtDNA testing -help...!!!!!

jayneebradley — 1 Jun 2008 11:03:17 GMT

I have just had my maternal DNA tested and given one mutation against the European reference sequence, at position 311 ???

I keep hearing talk of haplogroups ???? Should I have been given this information ???

Join the new J1 Ancestry Group!

RouX_Renard — 8 Jun 2008 10:15:17 GMT

Hi,

A new Group has been created at Ancestry for members of the rare J1 genetic haplogroup.

If YOU are a J1 male (or if you are fortunate enough to be the wife or daughter of one) please join the new "J1 Group" here at Ancestry.com

http://groups.ancestry.com/Home.aspx?mfsid=35988797&att=...

See you there!

regards,

RouX

Kitts Project - DNA TESTING

celticsign1 — 2 Jun 2008 2:42:23 GMT

The Kitts project is just starting up. This is a way to find out who is related to whome and to validate existing reseach. If you are interested in this project please go to http://www.FamilyTreeDNA.com. Thank you

DNA test says J2 but i am a white Englishman, i am confused

gavrelle — 29 May 2008 9:54:21 GMT

Dear All, I got my test back and it says J2, essentially middle east and south europe. I have traced my tree back 400 years and they are all english born etc, surname Tullett/Tulett/Tallett, am i confused or what, any ideas???

DNA test result help

vegasgrl24 — 22 May 2008 2:14:03 GMT

I had DNA test results done by Gene Tree about a year ago and I don't know how to decipher them. It was an ancestry by DNA test. Can anyone help?

Evans family in PA

rebornblessed — 23 May 2008 10:00:40 GMT

The Family of Immigrant Ancestor Richard Evans [1669 - 7 Jan 1702 probate] > Samuel [1691-30 Sep 1770] [area of Maryland and Pennsylvania] are doing DNA testing with very interesting results.
Later descendants migrated to Ohio, West Virginia, Kentucky and other locations.
If you descend from this line of Evanses, please contact us at
listadministratorevans@earthlink.net

Genealogy with DNA testing

RaymondCoon46 — 22 May 2008 5:42:28 GMT

Our similar sounding surnames (Coon, Koones, Koons, Koontz, Coonts, etc.) have been mispelled so many times through the years by well-meaning recorders that it's difficult if not impossible to know by surname spelling who a person is. My GGGGrandfather's name was spelled Cone, Coon, Koontz, in the same county in just a twenty year span.

Here's some new information about DNA testing that may help some people:

Regarding genealogical DNA testing, here's a little more information to help calm fears about insurance companies using DNA information against us:

May 21, 2008

"President George W. Bush signed into law today the the Genetic Information Nondiscrimination Act (GINA). GINA - the first and only federal legislation that will provide protections against discrimination based on an individual's genetic information in health insurance coverage and employment settings.

"Today marks the beginning of a new era in health care," said Representative Louise Slaughter (D-NY). "Americans can finally take advantage of the tremendous potential of genetic research without the fear that their own genetic information will be used against them."

Just a few weeks ago, GINA received overwhelming support in both the Senate, with a unanimous vote of approval, and the House of Representatives, where the legislation was passed by a landslide vote of 414-1.

The health insurance protections offered by GINA are expected to roll out 12 months after the bill is signed, whereas the employment protections will be fully realized in 18 months.

Specifically, the legislation protects against genetic discrimination by health insurers or employers by:
Prohibiting group health plans and issuers offering coverage on the group or individual market from basing eligibility determinations or adjusting premiums or contributions on the basis of genetic information. They cannot request, require or purchase the results of genetic tests, or disclose genetic information.

Prohibiting issuers of Medigap policies from adjusting pricing or conditioning eligibility on the basis of genetic information. They cannot request, require or purchase the results of genetic tests, or disclose genetic information.

Prohibiting employers from firing, refusing to hire, or otherwise discriminating with respect to compensation, terms, conditions or privileges of employment. Employers may not request, require or purchase genetic information, and may not disclose genetic information. Similar provisions apply to employment agencies and labor organizations."

Everyone of us loses millions of skin cells every day, sheds hair (or get it cut), clip our nails, lick envelopes, and otherwise leave our DNA all over the landscape. We've been doing it all of our lives. If insurance companies wanted your DNA, they would have had it long ago.

Further, your name does not need to be associated with the test results in any way, if that's the way you want it done. You can collect the sample and then use only the surname to identify the sample. (FTDNA would like to keep the surname associated with the sample for research, but other information such as first and middle name, etc., can be left blank.)

The Coon/Coons/Coombs/Koontz, etc., etc., DNA research group is at FamilyTreeDNA.com There are 59 members and 30 have found a connection with another member. www.familytreedna.com/public/Coon

DNA testing and genealogy

RaymondCoon46 — 22 May 2008 5:39:56 GMT

Genealogy and DNA testing

RaymondCoon46 — 22 May 2008 5:38:01 GMT

DNA testing for Genealogy

RaymondCoon46 — 22 May 2008 5:37:02 GMT

DNA testing for Genealogical purposes

RaymondCoon46 — 22 May 2008 5:34:34 GMT

YDNA Haplogroups

Moutrey — 8 May 2008 5:16:37 GMT

A relative sent me his 56 marker YDNA results but did not provide the Haplogroup. Is there some way I can figure it out? I searched at YSearch but did not find any exact matches.
Thanks

Did the ancestry.com DNA test and didn't tell me much at all! :(

TheresaRGriffiths — 16 May 2008 11:08:41 GMT

I did the female Maternal test because I have no male line carrying either name alive.
So just for the heck of it I did the test for myself.
Maybe I don't understand the DNA thing it's all new to me, but I thought it would of broke some of the info down or something. All I got was telling me I was a ( see below )
And below is all the info it gave me!!
I am very disappointed with my test results.
Not sure really what I expected, but I do know it was more than what they gave me! :(

Theresa theresagriffiths@iwon.com

K

Maternal Ancient Ancestry Haplogroup K, a subgroup of haplogroup U, originated in the Middle East roughly 20,000 years ago and expanded into Europe around or before the Last Glacial Maximum roughly 15,000 years ago. These early hunter/gatherer populations then suffered extinction or great reductions in population size at the onset of the Last Glacial Maximum as they sought refuge in the more temperate climate of southern Europe. After the ice age came to an end these populations then re-expanded into the rest of Europe about 10,000 years ago. Haplogroup K is found at high frequencies among Ashkenazi Jewish populations. The Tyrolean Iceman and news anchorwoman Katie Couric both belong to Haplogroup K.

Ancestry.com DNA Anaylsis - Wrong Haplotype Prediction??

Seasong75 — 16 May 2008 8:09:51 GMT

I need help, please! I'm a newbie.

I recently received the analysis of my brother's DNA. The results showed that our haplotype prediction was predicted as E3b. However, when I tried to join a E3b project group, I was told our haplotype was Q based on predictor programs on other websites. I tried these programs and got a Q haplotype also. Although they kindly said I could join their group, it seemed useless if my haplotype is not E3b.

I contacted Ancestry.com DNA project about this situation to no avail. I just seem to be getting the runaround. They send me the same info, tests were done by Sorensons and they used the Cambridge predictor analysis, etc. I explained I wasn't questioning the accuracy of the tests done by Sorensons, just the analysis of the haplotype.

Has anyone else run into this situation?? Or does anyone have any suggestions for me?

I realize the only accurate results would be if I did a specific haplotype DNA test, but how can 3 anayses show Q and only 1 show E3b?

It seems useless to have the haplotype prediction from Ancestry.com if you can't even use it to join a discussion group.

Thanks in advance for any assistance anyone can provide.

HELP ! Deciphering mtDNA results

UKecdy — 17 Apr 2008 8:21:46 GMT

Hello

I am hoping someone can help me put my mtDNA results into some kind of common speak English. Even reading a plethora of online stuff doesn't answer my questions. Mutations, clades, ?????

My mtDNA sequence is 126 189 294 and I used Oxford Ancestors, because I saw them mentioned on TimeTeam, so other reason.

Part of their reference quotes T9.. my husband is T6 and has a 3 x 4 mtDNA code, as opposed to my 3 x 3.

I've seen stuff about T*, T1... but none of it means anything, do I take it that T6 has been around longer than T9, and if so, what does that mean?

Oxford Ancestors also put a star on a 7 Daughters of Eve certificate.. my star is at a different point to my husband's, and their explanation says "the longer the line the more mutations*.. I have the longest line out there but no idea how to work out what it all is.

Any help would be gratefully received.

Eileen

VanMeter Surname Project

Elsien57 — 7 May 2008 4:20:42 GMT

http://www.familytreedna.com/public/VanMeterSurnameProject/

We need your help. Email me if you have any questions or are just curious.

SMGF - We've Got The Results, Now What?

VAHutchinson — 16 Apr 2008 4:33:38 GMT

I've read through many of the posts regarding the SMGF database. When I first investigated it, someone sent me two different links (other than the search function on their web site) to look through their data base. Unfortunately, now that the results are in (or do they just send you an invitation to buy a maternal test as well as soon as they receive your paternal test in?) I can't find that information anywhere to save my soul. There are few members with our surname in the SMGF data base (Hutchinson) and of the eight there, none of them have the right pedigree for my cousin's results.

How long have people been finding it takes to get results from the paternal DNA tests back from SMGF? Is using the last name in the search function enough, or do you have to find 7 markers that match your line before it will bring up your record? From the looks of it, as long as we put the last name in it appears to pull up everyone, whether any of their markers match or not.

Many thanks to anyone who can help me understand how to search the SMGF database productively.

Boothe/Booth DNA Project

4soldz — 28 Apr 2008 12:14:06 GMT

FTDNA has started a DNA project for the Boothe/Booth surname. I encourage ALL who are interested to participate in this project. The more who participate the better the data.

Re: Information on Deyarmin Family Tree

deyartim — 26 Apr 2008 2:09:30 GMT

A DNA test site has begun at www.familytreedna.com/public/dearmond/ which includes the Y markers I inherited from William who died in Indiana county PA in 1836 (Wife: Elizabeth Bowers). It allows male surname descendents to test for and compare Y chromosome results with other males who have some variant of DEARMOND as a surname.

Re: samuel vance

anngrw152 — 23 Apr 2008 1:18:37 GMT

I am working with group 2 on the Vance DNA site. We have some members who match us in the Gallia Ohio area. Are you a Vance male direct descendant or have a male relative who is. We would really like to hear from you.Please let me know. DNA really helps with genealogy.Thank you. I think perhaps we can help you. Marilyn

mtdna N1b from Ireland

macmeg — 21 Apr 2008 7:06:05 GMT

I took the mtdna test and have traced my direct maternal side back to Kilkenny, Ireland. My results came back with the N1b. I looked it up on the internet and show that this is related to the Ashkenazi Jewish line.

Any clues,

Jeff Palmer

Hodge/Hodges/Hoge DNA Project

bartonterryj — 20 Jan 2004 2:56:34 GMT

Hello, I am Terry Barton; my mother is a Texas Hodges. We are descended from Richard Allen Hodges, b 1833 TN, m Mary Ann Woodard of Anderson Co TX.

I am Coordinator of the Barton DNA Project, which has been quite successful in sorting over 110 Barton men into 13 separate lineages. You can read more about it: http://www.bartondna.info/ I have been hoping that a Hodges/Hodge DNA project would emerge, but to date am unaware of one.

Is anyone interested in working together with me to create a Hodge/Hodges/Hoge DNA Project? I can help in providing my experience and in setting up the project and seek someone who can provide the day-to-day coordination after we get it kicked off. You can contact me directly at terry@bartonsite.org

Anyone who is interested in participating can also contact me directly. You’ll need to be a male Hodges, Hodge, Hoge (or other similar name) or be able to provide a living male relative for testing. (Lots of our Barton participants have been sponsored by an active female researcher)

best regards, Terry

Acadian and Amerindian Genealogy and DNA

mace111 — 15 Apr 2008 5:05:16 GMT

http://www.familytreedna.com/public/AcadianAmerIndian/

mtDNA results, now what???

gprice2665 — 28 Mar 2008 11:28:46 GMT

My husband took the Maternal and Paternal DNA tests.
He is an adoptee and doesn't have a clue to his biological background.
The results were many names of mtDNA matches with 0 differences. Can anyone tell me what the next step is?
He is Haplogroup H. Hvr1 and Hvr2 . 152-C, 263G, 315.1-C, 16519-C. Does this mean all those people are closely related??? He does not know his surname on either side.

Genetree vs. FTDNA

attylori — 11 Apr 2008 2:19:49 GMT

Can anyone tell me the difference between Genetree and Family Tree DNA regarding mtdna testing? I did the procedure where you unlock your SMGF results through Gene Tree. I am assuming this is the enahnced mtdna test from Gene tree, which I got for $19.99 because of my participating in SMGF. Will I find out any additional information if I test through FTDNA for mtdna doing a similar test (not the $450 one through FTDNA)?

DNA Testing

LyLLYe11 — 9 Apr 2008 11:15:44 GMT

I saw a post recently about DNA testing. Can anyone tell me more about that? What does it cost? I also heard that it is supposed to only be the males in the family is that true? If it is true I would love to talk to my male cousins about doing this. And how can I find out if my family Surname has a DNA testing group already started? And how do I find out about getting started?

Phillips Worldwide DNA Project

NancyKiser — 10 Apr 2008 3:07:59 GMT

My name is Nancy Kiser, and I am the Assistant Administrator of the Phillips Worldwide DNA Project, which is hosted by Family Tree DNA, a commercial testing company. We maintain two web sites at the following links:
http://www.worldfamilies.net/surnames/p/phillips/index.html
http://www.familytreedna.com/public/PhillipsWorldwide/index....

We currently have 260 participants and, through DNA analysis, have identified 31 separate, unrelated Phillips families. The majority of our participants live in the USA, although we do have a few participants who live in the UK, Canada and Australia. We are very interested in recruiting more participants from the British Isles and mainland Europe in an effort to identify the deep roots of all Phillips families worldwide.

If you are a male Phillips (or any variation of the name Phillips) and you live in the UK, Ireland or mainland Europe, we are willing to pay for your basic 12 marker DNA test if you are willing to supply a Phillips pedigree that goes back at least 5 generations. You do not have to have proof that anyone in your Phillips family ever migrated to the New World.

The DNA test is painless and only consists of swabbing the inside of your cheek to obtain cheek cells for analysis. A kit is mailed to you and you return your samples to the lab in a pre-paid, pre-addressed envelope. Your kit is given a number and this is the only way you are ever publicly identified to preserve your privacy.

Thank you for reading this message and I hope to hear from some of you soon. My email address is nancy_kiser@hotmail.com or nancy2kiser@yahoo.com.

Sincerely,
Nancy Kiser
Colorado, USA

Best DNA Tests?

judizimmer — 27 Feb 2008 3:42:01 GMT

My husband and I are considering getting DNA tests, but we wonder if one test is better than another. Same question for one labe being better than another. Pricing varies, so if a lower priced test iis as good as a more expensive one, we'd like to know.

How could someone with a 12 marker match be a different haplogroup?

44040 — 24 Oct 2007 2:29:29 GMT

My male cousin took the test, FTDNA predicts as does Ancestry, N3a for him but he has an exact 12 marker match from the same country (Finland) as someone who is haplogroup E3b? Is it bcause the other guy had more markers? I was told to sit tight and not upgrade at the moment.
Thanks--Jennifer

No Y-chromosome DNA match?

gprice2665 — 31 Jan 2008 3:02:36 GMT

I had the DNA test and nothing came back but
"No Y-Chromosome DNA Matches". Very disappointed.
Has anyone else had this experience??

HURD DNA Project

khurd77 — 7 Sep 2007 5:11:08 GMT

I wanted to announce that there will be a DNA project for the Hurd/Herd/Heard family started in the near future. I have initiated the test for myself and results should be available within a month. I noticed that there are no Hurd Family DNA projects currently. I encourage any Hurd Family Members to contribute.

DNA Testing

gatliffe1 — 24 Mar 2008 7:40:03 GMT

I would like to know how can you test DNA for people that been dead long before DNA was know about ? also can DNA be use for more then one family line say both my father and my mother lines with the same test ?

HELON Family DNA Project

ghelon — 24 Mar 2008 9:02:57 GMT

Announcing the HELON Family DNA Ancestry Project

ABOUT THE PROJECT:
All persons bearing the surname HELON (rendered GELON in the Ukrainian language and HOELUN/HULUN in the Mongolian language) are encouraged to join the HELON Surname Project. The goals of the HELON Surname Project are to bring together and unite all those whom bear this biblical and very ancient name wherever they may be throughout the World; to verify relationships and migratory paths of families; to identify - where possible - the HELON Patriarch/Matriarch; to attempt to quantify and validate the claims as to the biblical and ancient source of the name HELON and the geographical origins of the family, and to encourage others to actively share that information and documents that they may have on their famiies HELON with the aim of building an archive of substantiated proofs. As there are so few HELON families scattered throughout the World (albeit with some small concentrations), Members are encouraged to have undertaken more detailed Y-DNA37 or Y-DNA67 tests. ETHNIC ORIGIN: [Semitic] Ashkenazi Jewish/Greek/Scythian. Y-HAPLOGROUP = E3b1a [M35+; M78+; M96+; P2+; M107-; M123-; M136-; M148-; M165-; M2-; M281-; M34- & M81-]. N.B. 'Null' ['0'] Allele Value for DYS #425; Locus 48.

SURNAMES IN THE PROJECT:
Chudzik, Gelen, Gelon, Helon, Hoelun, Holon, Hulun, Misiura, Mulka, Rzadinec, Rzadziniec, Zadinec, Zaginski, Zebulon, Zebulun, Zielinski

JOIN THE PROJECT:
http://www.familytreedna.com/surname_det.aspx?group=Helon

Lancaster DNA Project

andreweninge — 18 Nov 2007 11:40:49 GMT

Hello everyone

I just wanted to let you know that the Lancaster DNA project currently has some discount vouchers for new participants from one of the commercial labs who do the testing for private genealogists. Could be a good time to get involved?

Please contact me if you are interested.

Best Regards
Andrew Lancaster

Fleury haplotype R1b1c7

wrdsrus — 15 Mar 2008 6:11:02 GMT

Hello everyone. My cousin and I have been researching our family history for quite some time, and ran across a stumbling block tracing our GGGrandfather, Robert D Fleury B 1832 Ireland, so my cousin (a direct male descendant) had DNA testing. We had always thought our family was orginally of French origin, and were quite surprised to learn we were of haplotype R1b1c7, descending apparently from Northern Ireland, and possibly from NIALL.

Can anyone more familar with DNA results fill in any blanks for us?

Is it possible that R1b1c7 also was in the area of France? Other possibiities we have been told is that perhaps we originated with a different last name, perhaps Fury Flury Flory or other.

I can find no immigration or emmigration information on Robert D Fleury.

Can anyone give me any clues as to where to go from here...we have been looking for the Irish link to Robert D Fleury for many years, and have come up with nothing concrete.

Any ideas or information, please respond on the board or e-mail directly at wrdsrus@aol.com

Thank you

Joyce Fleury

Announcing the Ramos Surname DNA Project.

mulkeyusa — 13 Mar 2008 2:33:45 GMT

Family Tree DNA is our testing company. http://www.familytreedna.com/public/Ramos

Pigg Family Project

wallacere12 — 21 Feb 2008 6:52:10 GMT

I am looking for interest in starting a Pigg family DNA group. Over time, many families have changed their surname, and as a result, family trees are quite a challenge. PThis family was one of the very early colonists in Virginia , with history in the US dating back to the 1600's.lease respond to this thread if you or your kin are interested.

Making sense of smgf results

attylori — 29 Feb 2008 4:13:53 GMT

I just discovered my results for mtdna were finally posted in smgf's database. I did a conversion that Ann Turner suggested on the rootsboard and found 393 matches, based on the same deviations from the Cambridge sequence. I don't totally understand what this means. Does this mean like 10,000 yrs. ago we had a common ancestor with these 393 people? Also, do the results tell me my haplogroup to discover my deep ancestry? This is all foreign to me! I am a DNA newbie!